| Primary Identifier | MGI:5755039 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr3a |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38). |
