|  Help  |  About  |  Contact Us

Allele : Polr3a<em2(IMPC)Tcp> polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:5755039 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr3a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38).
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele