|  Help  |  About  |  Contact Us

Allele : Radil<em1(IMPC)Tcp> Ras association and DIL domains; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755070 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Radil
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0369 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences gagtttactctgacatacct and CCCGTTGGCAGTGGTCTAGC. This resulted in a 2486 bp deletion from Chr5:142506252 to 142508737 encompassing ENSMUSE00001259653 & ENSMUSE00001280414 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories