| Primary Identifier | MGI:5755070 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Radil |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0369 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences gagtttactctgacatacct and CCCGTTGGCAGTGGTCTAGC. This resulted in a 2486 bp deletion from Chr5:142506252 to 142508737 encompassing ENSMUSE00001259653 & ENSMUSE00001280414 (GRCm38). |