| Primary Identifier | MGI:5755074 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Raly |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0318, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATCTATACTCAAATATAGTC, ATGTAAATGACTTTATTACC, CCTCCTAGTTCTTGTAGAGT, and GCAGTCAAAGTGTGAGACTT. This resulted in a 850-bp deletion from Chr2:154859330 to 154860179 (GRCm38). |
