|  Help  |  About  |  Contact Us

Allele : Raly<em2(IMPC)Tcp> hnRNP-associated with lethal yellow; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:5755074 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Raly
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0318, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATCTATACTCAAATATAGTC, ATGTAAATGACTTTATTACC, CCTCCTAGTTCTTGTAGAGT, and GCAGTCAAAGTGTGAGACTT. This resulted in a 850-bp deletion from Chr2:154859330 to 154860179 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele