| Primary Identifier | MGI:5755079 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rep15 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0362, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences TCAGCGGATACTCAAACCCG and GGAGAACCTAAGGCTATCAG. This resulted in a 388 bp deletion from Chr6:147032784 to 147033171 in ENSMUSE00000277388. This mutation is predicted to cause a frameshift with amino acid changes after residue 41 and early truncation 2 amino acids later (p.F41Vfs*4). (GRCm38). |