|  Help  |  About  |  Contact Us

Allele : Rep15<em1(IMPC)Tcp> RAB15 effector protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755079 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rep15
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0362, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences TCAGCGGATACTCAAACCCG and GGAGAACCTAAGGCTATCAG. This resulted in a 388 bp deletion from Chr6:147032784 to 147033171 in ENSMUSE00000277388. This mutation is predicted to cause a frameshift with amino acid changes after residue 41 and early truncation 2 amino acids later (p.F41Vfs*4). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele