| Primary Identifier | MGI:5755480 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rfc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rfc2-7423J-F4989 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACCTTGCCAGAATCTGCA, CAACACACAGAGGCTAAGCC, ATTGCTATGTCAACCCCACG, and TCGTGGGGTTGACATAGCAA, which resulted in a 413 bp deletion spanning exon 2 beginning at Chromosome 5 positive strand position 134,586,788 bp, GTGTTGGCATCACAGCTCCACCT, and ending after GGCCTCTATTTTTATTTATTT at 134,587,200 bp (GRCm38/mm10). This mutation deletes exon 2 and 343 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 33 and early truncation 36 amino acids later. |
