|  Help  |  About  |  Contact Us

Allele : Rbpms2<em1(IMPC)J> RNA binding protein with multiple splicing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755482 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rbpms2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Rbpms2-7534J-F9923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTAGAGAGGGCCCCAGA, GCTGTAAGACTTTTCCACAA, ACATATTCAGATCCTGAGAT, and TCTAGGCTGAGCCAGAGGGC, which resulted in a 270 bp deletion spanning exon 6 beginning at Chromosome 9 positive strand position 65,650,854 bp, CAACCTTCTGGGGCCCTCTCT and ending after CCTTCTCCTGCCCTCTGGCT at 65,651,123 bp (GRCm38/mm10). This mutation deletes exon 6 and 119 bp of flanking intronic sequence including the splice acceptor and donor. In addition to the large defined deletion there are two small deletions of 6 bp (CTTTCC) and 19 bp upstream of the 270bp deletion that will not affect the results of the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 69 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rbpms2<em1J>,
  • Rbpms2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories