|  Help  |  About  |  Contact Us

Allele : Pacrg<em1(IMPC)J> PARK2 co-regulated; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755130 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pacrg
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTGCGAGACGCAGAC, TTTTTATAAATTGACTTACG, GTCAGTCACACCTATCTGAA, and AGTGTGCAGCAGGCTGTGTA, which resulted in a 417 bp deletion beginning at Chromosome 17 negative strand position 10,597,238 bp, TTTTTGATGGGCTTTCTGAA and ending after CAGACTCTAACTTGTCCATTC at 10,596,822 bp (GRCm38/mm10). This mutation deletes 130 bp of ENSMUSE00001269415 (exon 3) and 287 bp of downstream intronic sequence including the splice donor. This mutation is predicted to result in a change of amino acid sequence after residue 95 and early truncation 16 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pacrg<em1J>,
  • Pacrg<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories