| Primary Identifier | MGI:5755131 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rmnd5b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rmnd5b-7482J-F6151 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTGTCCAGGGTCTAGGAG, CTAGTGTGTACTGGTTTGGC, ACATGTAGTAGGAAGCAGAC, and GTGTTTAACTCTGGCATGCA, which resulted in a 350 bp deletion spanning ENSMUSE00000293981 (exon 3) beginning at Chromosome 11 negative strand position 51,628,161 bp, GTGTTTAACTCTGGCATGCAG and ending after AGTGTGTACTGGTTTGGCAG at 51,627,812 bp (GRCm38/mm10). This mutation deletes exon 3 and 204 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change in amino acid sequence after residue 46 and early truncation 4 amino acids later. |
