|  Help  |  About  |  Contact Us

Allele : Rmnd5b<em1(IMPC)J> required for meiotic nuclear division 5 homolog B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755131 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rmnd5b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Rmnd5b-7482J-F6151 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTGTCCAGGGTCTAGGAG, CTAGTGTGTACTGGTTTGGC, ACATGTAGTAGGAAGCAGAC, and GTGTTTAACTCTGGCATGCA, which resulted in a 350 bp deletion spanning ENSMUSE00000293981 (exon 3) beginning at Chromosome 11 negative strand position 51,628,161 bp, GTGTTTAACTCTGGCATGCAG and ending after AGTGTGTACTGGTTTGGCAG at 51,627,812 bp (GRCm38/mm10). This mutation deletes exon 3 and 204 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change in amino acid sequence after residue 46 and early truncation 4 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rmnd5b<em1J>,
  • Rmnd5b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories