| Primary Identifier | MGI:5755133 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rusc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rusc1-7548J-M2497 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGATTTAATGTAGTGAGG, TGCAAAGCAAGAGGGTCCAG, TAGCTATCCACCCCAAACCC, and CCAAGGCTCATTCAGAAGGC, which resulted in a 261 bp deletion spanning exon 4 of ENSMUSE00000341390 beginning at Chromosome 3 negative strand position 89,089,651 bp, CTTCTGAATGAGCCTTGGTT and ending after GGCTAGCCACGCCTCTGGACC at 89,089,391 bp (GRCm38/mm10). This mutation deletes exon 4 and 184 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 479 and early truncation 4 amino acids later. |
