|  Help  |  About  |  Contact Us

Allele : Hsd17b8<em1(IMPC)J> hydroxysteroid 17-beta dehydrogenase 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755139 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hsd17b8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project H2-Ke6-7445J-M8453 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAACACCAAAGACCACAA, CACCAAAGACCACAAAGGGC, CCCTTCTTCTCCCGCTTCCG, and GGCTCTCGCTGACATGGCCC, which resulted in a 415 bp deletion spanning ENSMUSE00000300481 (exon 2) beginning at Chromosome 17 negative strand position 34,027,961 bp, CCATGTCAGCGAGAGCCACC and ending after GGCCCTTTGTGGTCTTTGGTG at 34,027,547 bp (GRCm38/mm10). This mutation deletes exon 2 and 197 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 14 and early truncation 18 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • H2-Ke6<em1J>,
  • H2-Ke6<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories