|  Help  |  About  |  Contact Us

Allele : Ccdc30<em1(IMPC)J> coiled-coil domain containing 30; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755389 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc30
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ccdc30-7437J-M5774 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATCTGAGAGGATATGCCAA, AGACTACCATTCCGGCTGTG, GCAAGTATGCTCAGGATACG, and CGTGTCAGAGACACGCACAT, which resulted in a 311 bp deletion, spanning ENSMUSE00000449557 (exon 3) beginning at Chromosome 4 negative strand position 119,401,203 bp, GTATCCTGAGCATACTTGCTGT and ending after TCCCCAAGTCTTCAAGAAAT at 119,400,873 bp (GRCm38/mm10), but with 20 bp of intronic sequence, GTGGGGTGATCTGAGAGGAT, retained. This mutation deletes exon 3 and 160 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after residue 55 and early truncation 10 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ccdc30<em1J>,
  • Ccdc30<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories