| Primary Identifier | MGI:5755393 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 1700001O22Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project 1700001O22RIK-7435J-M5756 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACCCTCTTGATGAAGGA, TGCCTTGAGTGCTACCAAGG, GATGGAGACAGTCCTCGCTT, and GGTGTGTGTGCGCGGAGTCT, which resulted in a 205 bp deletion spanning ENSMUSE00001303738 (exon 2) beginning at Chromosome 2 negative strand position 30,801,093 bp, TCTGGGGTTCCCAAGCGAGG, and ending after CGGAGGGGACCCTCTTGATG at 30,800,889 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are 2 small insertions of 14 and 7 bp in the intron sequence, which do not affect the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 139 and early truncation 139 amino acids later. |