|  Help  |  About  |  Contact Us

Allele : 1700001O22Rik<em1(IMPC)J> RIKEN cDNA 1700001O22 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755393 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  1700001O22Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project 1700001O22RIK-7435J-M5756 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACCCTCTTGATGAAGGA, TGCCTTGAGTGCTACCAAGG, GATGGAGACAGTCCTCGCTT, and GGTGTGTGTGCGCGGAGTCT, which resulted in a 205 bp deletion spanning ENSMUSE00001303738 (exon 2) beginning at Chromosome 2 negative strand position 30,801,093 bp, TCTGGGGTTCCCAAGCGAGG, and ending after CGGAGGGGACCCTCTTGATG at 30,800,889 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are 2 small insertions of 14 and 7 bp in the intron sequence, which do not affect the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 139 and early truncation 139 amino acids later.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • 1700001O22Rik<em1J>,
  • 1700001O22Rik<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele