|  Help  |  About  |  Contact Us

Allele : Otogl<em1(IMPC)J> otogelin-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755623 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Otogl
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Otogl-7415J-M363 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCTGAGATGGTCCCTTGG, GAGATGGTCCCTTGGTGGTG, CCATGATCGAGACCGTCTCG, and CCCGAGACGGTCTCGATCAT, which resulted in a 270 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 107,903,262 bp, CCCCGAGACGGTCTCGATCA, and ending after TGAGATGGTCCCTTGGTGGT at 107,902,993 bp (GRCm38/mm10). This mutation deletes exon 4 and 203 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 47 and early truncation 119 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Otogl<em1J>,
  • Otogl<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories