|  Help  |  About  |  Contact Us

Allele : Stk11ip<em1(IMPC)J> serine/threonine kinase 11 interacting protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755625 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Stk11ip
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Stk11ip-7486J-M6232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAAGGCTAGGATTTTTGCT, GTGGAATATCTCAAGTACAG, CCTGCCTTCATCACTCCCTA, and AAGGAACATTCAGGTTAGCG, which resulted in a 479 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 75,524,596 bp, GTACAGAGGAGAGTGGGTGC, and ending after CCTGCCTCGCTAACCTGAAT at 75,525,074 bp (GRCm38/mm10). This mutation deletes exon 3 and 273 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 8bp insertion in the intron that will not affect the exon deletion. The 479 bp deletion is predicted to cause a change in amino acid sequence after 20 residues and early truncation 120 amino acids later.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • LKB1IP<->,
  • Stk11ip<em1J>,
  • Stk11ip<em1J>,
  • LKB1IP<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories