| Primary Identifier | MGI:5755625 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Stk11ip |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Stk11ip-7486J-M6232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAAGGCTAGGATTTTTGCT, GTGGAATATCTCAAGTACAG, CCTGCCTTCATCACTCCCTA, and AAGGAACATTCAGGTTAGCG, which resulted in a 479 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 75,524,596 bp, GTACAGAGGAGAGTGGGTGC, and ending after CCTGCCTCGCTAACCTGAAT at 75,525,074 bp (GRCm38/mm10). This mutation deletes exon 3 and 273 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 8bp insertion in the intron that will not affect the exon deletion. The 479 bp deletion is predicted to cause a change in amino acid sequence after 20 residues and early truncation 120 amino acids later. |
