| Primary Identifier | MGI:5755647 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab6b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab6b-7421J-M4508 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAAGACCAGCCTATGGCTA, CTAGCCATAGGCTGGTCTTA, GCTCTCCAGACAGGGTCCAC, and AGGGAGCATTGAGCTCAGAG, which resulted in a 178 bp deletion spanning exon 2 beginning at Chromosome 9 positive strand position 103,140,328bp, CCTAGCCATAGGCTGGTCTT and ending after CTCTGTCTCTGCCTGTGGAC at 103,140,505 bp (GRCm38/mm10). This mutation deletes exon 2 and 119 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 23 and early truncation 5 amino acids later. |
