|  Help  |  About  |  Contact Us

Allele : Rnf144a<em1(IMPC)Tcp> ring finger protein 144A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755081 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnf144a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0404, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in deletion of 775-bp on Chr12:26327094 to 26327868 deleting exons ENSMUSE00000107366 and ENSMUSE00000107364 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 46 and early truncation 21 amino acids later (p.C46Rfs*23). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories