| Primary Identifier | MGI:5755083 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Scarb2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0266, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AATCCTGAGGAGATCCTCCA and AACTGGATGTACACAGGTAG. This resulted in a 11 bp deletion from Chr5:92485237 to 92485249 encompassing ENSMUSE00000321438. This mutation is predicted to cause a frameshift with amino acid changes after residue 75 and early truncation 3 amino acids later (p.I75Kfs*5). (GRCm38). |