|  Help  |  About  |  Contact Us

Allele : Scarb2<em2(IMPC)Tcp> scavenger receptor class B, member 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:5755083 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Scarb2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0266, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AATCCTGAGGAGATCCTCCA and AACTGGATGTACACAGGTAG. This resulted in a 11 bp deletion from Chr5:92485237 to 92485249 encompassing ENSMUSE00000321438. This mutation is predicted to cause a frameshift with amino acid changes after residue 75 and early truncation 3 amino acids later (p.I75Kfs*5). (GRCm38).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories