|  Help  |  About  |  Contact Us

Allele : Tmem160<em1(IMPC)Tcp> transmembrane protein 160; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755091 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem160
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AGTGTCCGAGCTGGATCGCG and ACTTCTGTCATCCGGCATTG. This resulted in a 1,033 bp deletion from Chr7:16453129 to 16454161 and 16 bp deletion from Chr7:16454205 to 16454221, from within exons ENSMUSE00000384664 and ENSMUSE00000198013, removing the splice donor site from the distal exon. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 5 amino acids later (p.R57Wfs*7) (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories