| Primary Identifier | MGI:5755455 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Rmrp |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated by injecting Cas9 RNA and guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG), resulting in a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals. |
