|  Help  |  About  |  Contact Us

Allele : Rmrp<em1Litt> RNA component of mitochondrial RNAase P; endonuclease-mediated mutation 1, Dan R Littman

Primary Identifier  MGI:5755455 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Rmrp
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated by injecting Cas9 RNA and guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG), resulting in a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals.
  • mutations:
  • Single point mutation
  • synonyms:
  • Rmrp<G270T>,
  • Rmrp<G270T>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele