| Primary Identifier | MGI:5755665 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eipr1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later. |
