|  Help  |  About  |  Contact Us

Allele : Eipr1<em1(IMPC)J> EARP complex and GARP complex interacting protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755665 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eipr1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Tssc1<em1J>,
  • Eipr1<->,
  • Tssc1<em1J>,
  • Eipr1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele