|  Help  |  About  |  Contact Us

Allele : Tpd52l1<em1(IMPC)J> tumor protein D52-like 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755683 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tpd52l1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tpd52l1-7503J-M9170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGAACTTGAGTTAAGTTA, ACCCGGAAGCGGAATCGGGG, CTTTGAAAAGTCAATCCGCG, and CATTCTTTAAGGTCACTCCG, which resulted in a 361 bp deletion spanning exon 3 beginning at Chromosome 10 negative strand position 31358175bp, ACTCCGTGGTGAGGTCACTT, and ending after TTCAGTCCCGCCCCGATTC at 31357815 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 45 and early truncation 20 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tpd52l1<em1J>,
  • Tpd52l1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories