Primary Identifier | MGI:5763283 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tmcc3 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Tmcc3-7561J-M9674 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACAGGTGTTCCAACGGCG, CCCTGAATCCCAATTCTAGG, CCTGGAAAAATCCTACACCG and TTAGGCAACCGGGTAACAGA, which resulted in a 497 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 94,582,088 bp, CCTAGAATTGGGATTCAGGG, and ending after CTGTTGGCTTATGTTCCCTCT at 94,582,584 bp (GRCm38/mm10), with 3 base pairs (CCG) retained in place of this deletion. This mutation deletes exon 3 and 361 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 332 and an early truncation after an additional 27 amino acids. |