| Primary Identifier | MGI:5763786 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam110d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Grrp1-7625J-M2529 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCACCACCGACACCGTG, GCGGCGACGTTGCGACCTGA, TCACCCACTACACCTTCGAG and TATCTTTTACCGCCAGAAGA, which resulted in a 698 bp deletion in exon 2 beginning at Chromosome 4 negative strand position 134,252,135 bp, AGGGGACGAACCCCCAGCGCC, and ending after GCGGGACGGACGCCCCACGGT at 134,251,438 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 26 amino acids later. |
