| Primary Identifier | MGI:5763623 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | St6galnac3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project St6galnac3-7558J-M9635 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACGTCATGAGCCAACACAG, GTTCACTTGACAGCCGGCAG, TTGATTCCTCAAGCACTCAT and GCTACAGGTGTAGCCTTTAT, which resulted in a 708 bp deletion spanning exon 3 beginning at Chromosome 3 negative strand position 153,412,014 bp, GTCCAATAAAGGCTACACCT, and ending after CGTCATGAGCCAACACAGAG at 153,411,307 bp (GRCm38/mm10). This mutation deletes exon 3 and 298 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 31 amino acids later. |
