|  Help  |  About  |  Contact Us

Allele : Wscd2<em1(IMPC)J> WSC domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5763626 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wscd2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Wscd2-7568J-M3187 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGGGCAGTAGGAACTAG, GTTTCCATCTCTTGAATATC, GGACATGTCTGGGGATATGG and GTTCGCCTTGGCTTGTCAGA, which resulted in a 388 bp deletion spanning exon 3 (ENSMUSE00000478656) beginning at Chromosome 5 positive strand position 113,558,183 bp, AGTTCCTACTGCCCATATTGG and ending after TTCGCCTTGGCTTGTCAGAG at 113,558,570 bp (GRCm38/mm10) with 3 base pairs (AAT) left in place of this deletion. This mutation deletes exon 3 and 270 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 133 and a early truncation an additional 24 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Wscd2<em1J>,
  • Wscd2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories