| Primary Identifier | MGI:5763626 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wscd2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Wscd2-7568J-M3187 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGGGCAGTAGGAACTAG, GTTTCCATCTCTTGAATATC, GGACATGTCTGGGGATATGG and GTTCGCCTTGGCTTGTCAGA, which resulted in a 388 bp deletion spanning exon 3 (ENSMUSE00000478656) beginning at Chromosome 5 positive strand position 113,558,183 bp, AGTTCCTACTGCCCATATTGG and ending after TTCGCCTTGGCTTGTCAGAG at 113,558,570 bp (GRCm38/mm10) with 3 base pairs (AAT) left in place of this deletion. This mutation deletes exon 3 and 270 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 133 and a early truncation an additional 24 amino acids later. |
