| Primary Identifier | MGI:5763008 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Anks3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Anks3-7436J-F5765 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTCGAACTGAAGGCCTAG, CCAAAAACCCGGGTGCTCAC, ACTTACCTGGGGATGAATGG and TATACCCAGCATCTCACATG, which resulted in a 298 bp deletion spanning ENSMUSE00000292922 (exon 3) beginning at Chromosome 16 negative strand position 4,958,217 bp, AAGCCACATGTGAGATGCTG, and ending after GGTGCTCACTGGTTGCCTTG at 4,957,920 bp (GRCm38/mm10). This mutation deletes exon 3 and 99 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 10 bp deletion in the 5-prime intron, 68 before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 57 and early truncation after an additional 6 amino acids. |
