|  Help  |  About  |  Contact Us

Allele : Acot2<em1(IMPC)J> acyl-CoA thioesterase 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5763009 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Acot2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Acot2-7575J-M3846 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGGTGCTTGAAGACCGGA, GGAAACTGTGGACTCAGCCC, CGTTGATGAGGAGATCTGAT, TATAGACTGTCTCCCAGACA, which resulted in a 378 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 83,990,413 bp, CTTTATGATCAGTCTGAAAC, and ending after TTGTGGCAGCCCCTCCCTGT at 83,990,790 bp (GRCm38/mm10). This mutation deletes exon 2 and 175 bp of flanking intronic sequence including the splice acceptor and donor. There is also a 4 bp deletion in the 5-prime intron 16 bp before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 193 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Acot2<em1J>,
  • Acot2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories