| Primary Identifier | MGI:5763010 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc32 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ttc32- 7506J-M9214 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACAACACGCTGTGTGGA, AGCCCCACGAAAGTCGCCGA, AGAGCGATCAGCTGTCGTGA and AGGTTTAGAGCTAAGGAACA, which resulted in a 489 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 9,034,742 bp, GTCGCCGATGGTCTTCCACA, and ending after TTTAGAGCTAAGGAACAAGGAA at 9,035,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 46 and early truncation after an additional 3 amino acids. |
