|  Help  |  About  |  Contact Us

Allele : Ttc32<em1(IMPC)J> tetratricopeptide repeat domain 32; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5763010 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ttc32
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ttc32- 7506J-M9214 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACAACACGCTGTGTGGA, AGCCCCACGAAAGTCGCCGA, AGAGCGATCAGCTGTCGTGA and AGGTTTAGAGCTAAGGAACA, which resulted in a 489 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 9,034,742 bp, GTCGCCGATGGTCTTCCACA, and ending after TTTAGAGCTAAGGAACAAGGAA at 9,035,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 46 and early truncation after an additional 3 amino acids.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ttc32<em1J>,
  • Ttc32<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele