|  Help  |  About  |  Contact Us

Allele : Tex2<em1(IMPC)J> testis expressed gene 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5763013 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tex2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tex2-7559J-M9640 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAATAATGACCTAAAGGC, TGAGTGTGCACCTGTTTAAA, TACAGTCAGATCATGACAGA and GGATACATTTCAGAGATGGC, which resulted in a 610 bp deletion spanning exon 4 beginning at Chromosome 11 positive strand position 106,546,571 bp, AGGCCGGCTTCCTGTCTGCC, and ending after TACATTTCAGAGATGGCTGG at 106,547,180 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 613 and an early truncation after an additional 15 amino acids.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tex2<em1J>,
  • Tex2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories