| Primary Identifier | MGI:5763137 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bzw1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Bzw1-7578J-M3933 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGTGGCTCAAAACTAGCG, ACGCACTGCTTTCTGCCGCC, GTGTGGGTCTTGGTGAAATA and ATATCACCCATATCGCTATA, which resulted in a 308 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 58,398,906 bp, GCGCGGTAGCCCTGGCGGCA, and ending after AAGGGTGTGGGTCTTGGTGAA at 58,399,213 bp (GRCm38/mm10). This mutation deletes exon 4 and 213 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change of amino acid sequence after residue 112 and early truncation 2 amino acids later. |
