| Primary Identifier | MGI:5763150 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Iqca1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Iqca-7545J-F2516 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAAACCCCACCACCATG, CGAAGAAGTCTGCAGACAAT, GCACCTTTAACAGAACCCAC and GTGGATAGCATTCATCCATG, which resulted in a 524 bp deletion spanning exon 2 beginning at Chromosome 1 negative strand position 90,145,184 bp, TCATCCATGAGGTTGTCTAA and ending after ACTCAAACCCCACCACCAT at 90,144,661 bp (GRCm38/mm10) with a single base pair insertion, A, in place of this deletion. This mutation deletes exon 2 and 199 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 4 and early truncation 11 amino acids later. In addition, there is a 4 bp (gtgg) deletion 39 bp before the 524 bp deletion that is not predicted to impact the outcome of this mutation. |