| Primary Identifier | MGI:5763461 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cuedc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cuedc1-7438J-M5795 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACTCCTAGGACACGTCCT, ACCTAAGGCCAGCATCGCCA, ATTTTTGTCTCAGAGCGCAG and GTGGCAAGAGACATTTTCAC, which resulted in a 435 bp deletion spanning ENSMUSE00001255541 (exon 3) beginning at Chromosome 11 positive strand position 88,177,110 bp, GCCAAGGAGTAGCTCCTAGC, and ending after TGTGGCAAGAGACATTTTCAC at 88,177,544 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 114 and early truncation 1 amino acid later. |
