| Primary Identifier | MGI:5763463 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cnksr2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cnksr2-7605J-M4582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAAGTAACCCCACATACAT, TGTACAAACCGATGTATGTG, TTGTCCCACTGCCATCACAT and GAAAAGCTTTTAATAAATAA, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome X negative strand position 157994008 bp, CATAGGATGATGAAAAGCTT, and ending after TAAGTAACCCCACATACATCG at 157993688 bp (GRCm38/mm10). This mutation deletes exon 3 and 118 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 76 and early truncation 14 amino acids later. |
