| Primary Identifier | MGI:5763464 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Patj |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Inadl-7544J-M2535 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACCTGCGTGCGTGTTAGC, AACTGACGCTGCTCAGCACA, CACCTGCTGCTGATTTTGAA and AGTAACACTAGCCTTGGTGC, which resulted in a 395 bp deletion spanning exon 5 beginning at Chromosome 4 positive strand position 98,410,884 bp, GTTAGCCGGCTGCTGAGCATG, and ending after GTAACACTAGCCTTGGTGCTG at 98,411,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 129 and early truncation 6 amino acids later. |
