|  Help  |  About  |  Contact Us

Allele : Patj<em1(IMPC)J> PATJ, crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5763464 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Patj
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Inadl-7544J-M2535 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACCTGCGTGCGTGTTAGC, AACTGACGCTGCTCAGCACA, CACCTGCTGCTGATTTTGAA and AGTAACACTAGCCTTGGTGC, which resulted in a 395 bp deletion spanning exon 5 beginning at Chromosome 4 positive strand position 98,410,884 bp, GTTAGCCGGCTGCTGAGCATG, and ending after GTAACACTAGCCTTGGTGCTG at 98,411,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 129 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Patj<em1J>,
  • Patj<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories