| Primary Identifier | MGI:5766262 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Frmpd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Frmpd1-7623J-M1181 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCAGCCCAAGGATAACAG, ATACACAGAATTTCAAAAGG, GCCCAGCTACTCTCCCTAAG and TGCCTTTTTTACAGGTCAGG, which resulted in a 301 bp deletion spanning exon 3 beginning at Chromosome 4 positive strand position 45243539 bp, CTTTCCTCTGTTATCCTTGGG, and ending after TAGCCTCTTAGGGAGAGTAG at 45243839 bp (GRCm38/mm10). This mutation deletes exon 3 and 143 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 10 amino acids later. |
