| Primary Identifier | MGI:5766772 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ier2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ier2-7674J-M6979 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCAGCAGCGATTTGAGCGA, TGAGCATATTGTCGGCCGGG, ACTGCAACTTCGGCTTCCCG and TACCACTCTCGCATGCAGCG, which resulted in a 404 bp deletion and single base (A) insertion in exon 1 beginning at Chromosome 8 negative strand position 84,662,529 bp, GAAGCCGAAGTTGCAGTGGA, and ending after GCCTGCCGCCCGGCCGACAA at 84,662,126 bp (GRCm38/mm10). This mutation results in a change in amino acid sequence after residue 24 and early truncation 42 amino acids later. |