| Primary Identifier | MGI:5766773 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sdf2l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sdf2l1-7484J-F6196 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCCGTTCCGAAACCCACAG, GGCAGGGACCCAAAGACAGA, GTGATTAACAAGAATCCACG and CTTTTTAGTGTTCAAGACGA, which resulted in a 60 bp deletion beginning at Chromosome 16 negative strand position 17,131,827 bp, AATCCACGGGGTGGGGTGGG, and ending after GCCAACAGTCGGTAACCGGC at 17,131,768 bp (GRCm38/mm10). This mutation deletes 26 bp of ENSMUSE00000130280 (exon 2) and 34 bp of intronic sequence immediately preceding the exon and removes the splice acceptor, in addition there is a 9 bp (ccactaaat) insertion at this site, as well as a 3 bp deletion in the intron 29 bp before the 60 bp deletion. Finally there is a 61 bp deletion 162 bp after the 60 bp deletion, which deletes the last 9 bp of the exon and will not alter the results of the mutation. This mutation is predicted to cause the loss of exon 2 and to result in a change of amino acid sequence after residue 63 and early truncation 8 amino acids later. |
