| Primary Identifier | MGI:5774464 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp560 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp560-7726J-F3047 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGAACCATGTCAGCCGAA, TTACATCCATTCGGCTGACA, ATTCCCATATAGTCCAACAT and CATGGATGTCACTCTATCCT, which resulted in a 229 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 20,352,939 bp, TATGTTGGACTATATGGGAA, and ending after TGTTACATCCATTCGGCTGA at 20,352,711 bp (GRCm38/mm10). This mutation deletes exon 3 and 140 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 4 amino acids later. |
