| Primary Identifier | MGI:5775626 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zscan12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zscan12-7729J-M3081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCCTGCTCAAGCCCGGA, TCGATCGCACTCATTTTTCA, GTTTCTCGTTAAAAGTGAGA and AACAGGCTGATAGGACCCCA, which resulted in a 298 bp deletion spanning exon 3 beginning at Chromosome 13 positive strand position 21,366,532 bp, GGGCTTGAGCAGGCAGGAGC, and ending after GCTGTTTCTCGTTAAAAGTG at 21,366,829 bp (GRCm38/mm10). This mutation deletes exon 3 and 156 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 14 amino acids later. |