| Primary Identifier | MGI:5775635 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trav1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Trav1-7381J-M0733 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTTTAAACAATTCAACG, ATTTTTAAACAATTCAACGT, GCTGCACAGAAATTCTAAGA and AGCTGCACAGAAATTCTAAG, which resulted in a 434 bp deletion spanning exon 2 beginning at Chromosome 14 positive strand position 52,428,493 bp, ATTTTTTAAAATTAATTTTT, and ending after ACAGAAATTCTAAGAGGGAC at 52,428,926 bp (GRCm38/mm10). This mutation deletes exon 2 and 151 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 10 amino acids later, by run on into intron 2. |
