| Primary Identifier | MGI:5775649 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Paf1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Paf1-7694J-M6789 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAATGCAAGCGTCCAGCAT, TCCTAGAAGCTAAGCTTCTA, GGCCAGCAAAGGCCAGGCCT and CCATGAGGGATACCCAGGCC, which resulted in a 290 bp deletion and 6 bp insertion (ttgcaa) spanning exon 4 beginning at Chromosome 7 positive strand position 28,395,305 bp, CTGGACGCTTGCATTCAGAG, and ending after AGCAAAGGCCAGGCCTGGGT at 28,395,594 bp (GRCm38/mm10). This mutation deletes exon 4 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 6 amino acids later. |
