|  Help  |  About  |  Contact Us

Allele : Sh3d19<em1(IMPC)J> SH3 domain protein D19; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5775777 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sh3d19
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Sh3d19-7698J-M1095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGGACTAGCCATTGC, CCTGAATGTTTGGGCTCCCT, TCTTAGGCCTAACCACCGCT and AGCAACTGAACACTCGGAAC, which resulted in a 208 bp deletion spanning exon 3 beginning at Chromosome 3 positive strand position 86,098,069 bp, GGAGCCCAAACATTCAGGTC, and ending after CCAGTAAGTGATACCGAGCG at 86,098,276 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a stop after residue 266.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sh3d19<em1J>,
  • Sh3d19<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories